Hamowanie PKC łagodzi fenotyp serca w mysim modelu dystrofii miotonicznej typu 1 ad 8

Ro-31-8220 dostarczano codziennie od 2 godzin po pierwszym zastrzyku tamoksyfenem. Zwierzęta zawierające ludzki transgen CUGBP1 reagujący na tetracyklinę (TRECUGBP) dopasowano do myszy MHCrtTA, w których rtTA jest eksprymowany z użyciem specyficznego względem serca promotora (3-MHC (38). Myszy MHCrtTA / TRECUGBP i MHCrtTA były potomstwem F1 krycia TRECUGBP x MHC-rtTA. CUGBP1 indukowano stosując pożywienie zawierające 6 g / kg doksycykliny. Wszystkie eksperymenty przeprowadzono zgodnie z Przewodnikiem NIH dla opieki i wykorzystania zwierząt laboratoryjnych i zatwierdzone przez Komitet ds. Leczenia i Użytkowania Zwierząt w Baylor College of Medicine. Kwantyfikacja ekspresji EpA960 (R) za pomocą PCR w czasie rzeczywistym. Całkowitą ekstrakcję RNA i syntezę pierwszej nici cDNA opisano wcześniej (21). Real-time PCR przeprowadzono przy użyciu sondy TaqMan (TTACTCCCACAGCTCCTG), jak również starterów EpArecomb-recoF (GCCCCGGCTCTGACT) i EpArecomb-recoR (CAGCACAATAACCAGCACGTT), stosując TaqMan Universal PCR Master Mix na detektorze sekwencji ABI Prism 7500 (Applied Biosystems). Ekspresję RNA EpA960. u każdego zwierzęcia porównywano ze standardową krzywą generowaną z szeregu rozcieńczeń produktów cDNA zebranych z kilku zwierząt. GAPDH zastosowano jako kontrolę wewnętrzną, stosując wcześniej opisane startery (29). Przygotowanie próbek i analiza żelowa 2D. Lizaty tkanki mysiej tkanki serca przygotowano jak opisano wcześniej (21). Stężenie białka określono za pomocą testu BCA (Pierce). Do analizy 1D, 50 .g białka naniesiono na 10% SDS-PAGE, a następnie Western blot. Do analizy żelowej 2D mysie tkanki serca natychmiast zamrożono w ciekłym azocie i sproszkowano przy użyciu śmiertelnika i tłuczka. Proszek tkankowy ponownie zawieszono w 2D buforze mocznika, jak opisano poprzednio (17). Stężenia białka w oczyszczonych lizatach oznaczano za pomocą testu Bradforda (Bio-Rad). Analizę 2D / Western blot przeprowadzono przy użyciu 400 .g białka na Ettan IPGphor Isoelectric Focusing System (GE Healthcare), a następnie 10% SDS-PAGE, jak opisano poprzednio (17). Przewidywane pI niezmodyfikowanego CUGBP1 wynosi 8,5. Western blot i przeciwciała. CUGBP1 (50 kDa) wykrywano stosując przeciwciało monoklonalne (3B1) (1: 2500, Upstate). Inkubacje prowadzono przez noc w 4 ° C w 4% blotto (4% suche mleko w roztworze PBS). Przeciwciało specyficzne dla lekkiego łańcucha a. IgG-HRP (1: 5000, Jackson ImmunoReaseach Laboratories Inc.) zastosowano jako przeciwciało drugorzędowe, aby uniknąć wykrycia ciężkiego łańcucha mysiej IgG (51 kDa). Membrany przepłukano w PBS 0,5% Tween 20 przez 5. 10 minut 3 razy między inkubacjami w temperaturze pokojowej. Aktywowany PKCa / / II wykrywano stosując poliklonalne fosfospecyficzne (Thr638 / 641) przeciwciało PKCa / yll (1: 1000, Cell Signaling Technology). Filtry PVDF następnie odpędzono i powtórzono za pomocą specyficznego wobec PKC . przeciwciała monoklonalnego (1: 1000, BD Biosciences . Transduction Laboratories) w celu określenia całkowitego PKC. poziomy. Poziomy koneksyny 43 wykryto stosując przeciwciało poliklonalne (1: 1000; Zymed). Analiza splicingu RT-PCR. Całkowity RNA (3. 5. G) i 100 ng startera oligo (dT) zastosowano do syntezy pierwszej nici cDNA (21). Analizę PCR przeprowadzono jak opisano wcześniej (20). Sekwencje starterów do wykrywania alternatywnego składania eksonów 4 i 5 z Tnnt2, eksonu 21 z Ank2, eksonu 16 z Mtmr3, eksonów 6 i 23 z Sorbs1 i eksonu 5 z Mbnl1 opisano wcześniej (21, 30). Telemetria EKG. Telemetrię EKG u myszy bez znieczulenia i bez ograniczeń wykonano za pomocą implantu radiotelemetrycznego (Data Sciences International). Implant został umieszczony w jamie otrzewnowej za pomocą podskórnie tunelowanych elektrod w konfiguracji elektrokardiogramu ołowiowej II. Telemetrię rejestrowano co najmniej tydzień po operacji i przed wstrzyknięciem tamoksyfenu w celu ustalenia linii podstawowej. Zastosowano osiem zwierząt i podawano tamoksyfen przez 5 kolejnych dni, a połowę myszy otrzymywały codzienne iniekcje Ro-31-8220 przez 2 tygodnie, rozpoczynając 2 godziny po pierwszym zastrzyku tamoksyfenu. Telemetrię rejestrowano co 2 dni i ostatniego dnia iniekcji Ro-31-8220. Dane EKG zebrano i przeanalizowano za pomocą ECG Auto (technologie EMKA). Okresy rytmu zatokowego zostały zidentyfikowane i przeanalizowane w celu określenia częstości akcji serca, czasu PR i odstępu QTc oraz czasu trwania zespołu QRS. Funkcja serca. Badanie echokardiograficzne przeprowadzono na znieczulonych myszach (1,5% izofluranu zmieszanego z 95% tlenu). Myszy stabilizowano na ogrzewanej platformie i przyklejono taśmą do elektrod EKG. Ocenę czynności serca wykonano za pomocą ultradźwięku Visual Sonics Vevo 770 przy użyciu sondy 30 MHz. Analizę obrazu przeprowadzono za pomocą oprogramowania Visual Sonics w wersji 2.3.0, jak opisano wcześniej (39). Statystyka ANOVA użyto do porównania średnich z 3 lub więcej niezależnych grup. W przypadku wielokrotnych porównań zastosowano test wielokrotnego porównania Bonferroniego. Wartości P mniejsze niż 0,05 uznano za statystycznie istotne. Istotność statystyczna była wyświetlana jako gwiazdka wskazująca na różnicę w stosunku do myszy kontrolnych (MCM) na figurach. Materiały uzupełniające Zobacz dane uzupełniające Podziękowania Ta praca została wsparta dotacjami od NIH (R01 AR45653, do TA Cooper) i Stowarzyszenia Dystrofii Mięśni (do TA Cooper), stypendium podoktorskim Amerykańskiego Towarzystwa Kardiologicznego (do G.-S. Wang), oraz grant naukowy American Heart Association Scientist Development (dla MN Kuyumcu-Martinez). MN Kuyumcu-Martinez otrzymał nagrodę National Research Service Award od NIH oraz grant rozwojowy od Stowarzyszenia Dystrofii Mięśni. XHT Wehrens jest wybitnym młodym naukowcem w dziedzinie badań medycznych WM Keck Foundation, wspieranym przez stypendia Narodowego Instytutu Serca, Płuc i Krwi (HL089598-01, R01HL091947), Stowarzyszenia Dystrofii Mięśni (69238) oraz Fundacji Hankamera. Przypisy Konflikt interesów: Autorzy zadeklarowali brak konfliktu interesów. Informacje referencyjne: J. Clin. Invest.119: 3797. 3806 (2009). doi: 10.1172 / JCI37976.
[więcej w: najlepsza odzywka do rzes, mleko w proszku dla dzieci, ciasto marchewkowe wegańskie ]
[podobne: mmacore, ankos zapasy warszawa, trening pod sztuki walki ]